 |
|
||||
|
|||||
| About | Latest Articles | Back-Issues | Articles
|
Search | Instructions | Online Submission | Subscribe | Etcetera | Contact |
| |||||||||||||||||||||
|
Transcription activity of MMP-2 and MMP-9 metalloproteinase genes and their tissue inhibitor (TIMP-2) in acute coronary syndrome patients J Dabek1, J Glogowska-Ligus2, B Szadorska11 Department of Cardiology, Medical University of Silesia, Katowice, Poland 2 Department of Epidemiology, Medical University of Silesia, Katowice, Poland
Correspondence Address: Source of Support: None, Conflict of Interest: None DOI: 10.4103/0022-3859.113836
Background: Acute coronary syndromes (ACS) are a consequence of coronary vessel atherosclerosis and they are a leading cause of death in industrialized countries. One of the ACS causative factors is the deranged ratio equilibrium of the matrix metalloproteinase/tissue inhibitor of metalloproteinases (MMPs/TIMPs). Aims: Assessment of transcriptional activity of metalloproteinase genes using Human Genome-U133A oligonucleotide microarrays and selection of candidate genes differentiating ACS patients from healthy subjects and finally, QRT-PCR (quantitative real time polymerase chain reaction) confirmation of the results. Settings and Design: The study involved 67 ACS patients, admitted on a consecutive basis, to the Cardiology Clinic as well as 24 healthy subjects (control). Materials and Methods: Ribonucleic acid isolated from peripheral blood mononuclear cells was analyzed by QRT-PCR. Transcriptional activity of the analyzed gene was assessed with TaqMan gene expression assays. Statistical Analysis: U Mann-Whitney test was used to compare the results. Results: Homogeneity of the investigated group was assessed through hierarchical clusterization whereas the nine genes differentiating ACS patients from healthy persons were selected using the Bland-Altman technique. Among these genes three (platelet derived growth factor D, NUAK family SNF1-like kinase 1 and peroxisomal biogenesis factor 1) showed decreased transcriptional activity whereas the remaining six genes (MMP-2 and MMP-9, CDK5RAP3, transmembrane BAX inhibitor motif containing 1, adenylate cyclase-associated protein 1 and TIMP-2) were increased. MMP-2, MMP-9 and TIMP-2 were further characterized by QRT-PCR. Conclusions: The obtained results permit to conclude that the increased expression of MMP-2 and MMP-9 metalloproteinases and their tissue inhibitor (TIMP-2) is responsible for disturbed equilibrium of the metalloproteinase/tissue inhibitors system and as a consequence, for destabilization of atherosclerotic plaque and occurrence of the acute coronary syndrome in the investigated group of patients. Keywords: Acute coronary syndromes, genes differentiating, metalloproteinases
One of the key factors responsible for the pathomechanism of acute coronary syndrome (ACS) is the activation of matrix metalloproteinase (MMP) of the extracellular matrix. They play substantial roles in both physiological processes, such as embryogenesis and tissue restructuring, and in pathologies. [1] On one hand, their activation causes migration of vascular smooth muscle cells to the tunica intima (where their proliferation leads to the formation of atherosclerotic plaque); on the other hand, by degrading the fibrous cap of the plaque they cause its disruption. [2] Activity of metalloproteinases was reported to be regulated on the level of gene transcription, proteolysis and equilibrium of the metalloroteinases/tissue inhibitors system. [3]
The study was conducted in accordance to Helsinki Declaration-based Good Clinical Practice (GCP) rules following a positive opinion from the local Bioethics Commission which issued a relevant resolution (NN-6501-223/I/04) on December 21, 2004. Human Genome-U133A oligonucleotide microarrays (Affymetrix), allowing simultaneous analysis of 22283 genes, was used in the study. The study involved 91 subjects including 67 ACS patients, admitted consecutively to the Cardiology Clinic and 24 healthy subjects (control) - from the whole experimental group 11 subjects were picked up by choice to participate in the microarray screen (7 ACS patients and 4 healthy subjects). Coronary disease in healthy subjects was excluded based on the coronarography and the results of 64-slice computed tomography assessing arterial calcification index (calcium score). QRT-PCR (quantitative real time polymerase chain reaction) molecular studies were performed in 60 patients and 20 healthy subjects. Patients with ACS qualified for the study were not previously treated for coronary disease. All patients at admission underwent electrocardiogram and echocardiography as well as coronarography and basic laboratory tests (blood morphology with smear, erythrocyte sedimentation rate (ESR), lipidogram, glucose, creatinine and electrolytes in blood serum). In addition, all patients had markers of myocardial necrosis determined (troponin I and heart type creatine kinase-MB). As QRT-PCR control we used material from healthy subjects (n=20), that is never before treated, who reported with chest pain to emergency room. They were qualified to the control group based on an interview, physical examination, laboratory tests, and negative stress test. Inclusion criteria were: Age over 18, written conscious consent to participate, first lifetime "cardiac incident" (patients never treated before due to coronary disease) and chest pain lasting less than 12 h, changes in the ST-segment - T wave or left bundle branch block picture. Exclusion criteria were: Lack of consent, acute or chronic inflammatory conditions, autoimmune diseases, renal insufficiency, heavy hypertension, advanced cardiac insufficiency, and chest pain due to other causes. As study material, we used peripheral blood collected from ulnar vein of ACS patients within first 24 h of hospitalization. Blood was collected 6-12 h following the last meal. Ribonucleic acid (RNA) was isolated from mononuclear blood cells using the TRIzol reagent (Invitrogen). Next, RNA was purified using RNeasy Mini Kit columns (Qiagen). Amount and quality of RNA was assessed both spectrophotometrically and by electrophoresis in 1% agarose gel. In order to obtain the first complementary deoxyribonucleic acid (cDNA) strand 100 pM of T7-oligo (dT) 24 starter (5'- GCCAGTGAATTGTAATACGACTCACTATAGGG AGGCGG-3'), was added to 8 μg of RNA and incubated at 70°C for 10 min. Next, 5x first strand buffer, 0.1 M Dithiothreitol (DTT) and 10 mM deoxyribonucleotide triphosphates (dNTPs) were added to the reaction. After a short preincubation at 45°C a reverse transcriptase (SuperScript II, 200U, Invitrogen) was added to the reaction mix and the whole was incubated for another hour. In order to obtain the second cDNA strand, 5x second strand buffer, pyrogen-free water, 10 mM dNTPs, Escherichia More Details coli deoxyribonucleic acid (DNA) Polymerase I (40U, Invitrogen), E. coli DNA Ligase (10U, Invitrogen), Rnase H (2U), Invitrogen) were added. The mix was incubated for 2 h at 16°C. Next, T4 DNA polymerase I (10U, Invitrogen) was added to the reaction mix and the whole was further incubated at 16°C for another 5 min. The reaction was terminated by adding 0.5 M Ethylenediaminetetraacetic acid (EDTA) and the double-stranded cDNA was extracted using the phenol-chloroform. The obtained cDNA served as a template for the synthesis of biotinylated cRNA (BioArray High Yield RNA Transcript Labeling Kit, Enzo Life Sciences). The labeled cRNA was purified using RNeasy Mini Kit columns (Qiagen) and was next fragmented and hybridized to HG microarrays (HG-U133A, Affymetrix). Washing, staining and scanning procedures were carried out according to recommendations from the Manufacturer (technical manual). In order to eliminate unwanted variability between microarrays the results were normalized using the RMA Express software (gene expression summary values for Affymetrix Genechip data). Averages and SD of normalized fluorescence measurements for all transcripts present on HG-U133A microarray were compared. Next, cluster analysis of the results was performed. For the measure of similarity Euclidean distance was taken. The analysis was carried out using the Cluster 3.0 software (programs that provide a computational and graphical environment for analyzing data from DNA microarray experiments) and the results were visualized using Java Treeview. To discern genes differentiating ACS patients from healthy persons, the Bland-Altman method was used, taking into account three criteria: (1) Value of signal log ratio (SLR) for particular transcripts in the transcriptome separating them into two groups based on double SD from the average; (2) the area fulfilling the so-called "biological criterion" meaning the desired minimum value of SLR coefficient for the differentiating transcript (SLR min = ±1); (3) minimum value of fluorescence level making the differentiating transcript useful for real-time QRT-PCR analysis. The assessment of transcriptional activity of the chosen metalloproteinase genes was carried out using a commercial kit (TaqMan Gene Expression Assays, Applied Biosystems, CA, USA). The number of messenger Ribonucleic acid (mRMA) molecules of MMP-2, MMP-9, tissue inhibitor of metalloproteinases (TIMP)-2, β-actin and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes was determined based on the kinetics of QRT-PCR reaction and using ABI PRISM™ 7000 detector (Applied Biosystems, CA, USA) and a kit containing a fluorescent dye (ROX QuantiTect Probe RT-PCR, Qiagen, Germany). QRT-PCR reaction was carried out in one step using a reaction mix containing 25 μl 2x QuantiTect Probe RT-PCR Master Mix (HotStarTaq DNA Polymerase, QuantiTect Probe RT-PCR buffer (Tris-HCl, KCl, (NH 4 ) 2 SO 4 , 8 mM MgCl 2 , pH=8.7), dNTP mix, ROX reference dye, 0.5 μl QuantiTect RT Mix (Omniscript Reverse Transcriptase, Sensiscript Reverse Transcriptase at commercially available concentrations) and 1 μl starter and probe mix (TaqMan Gene Expression Assay, Applied Biosystems, CA, USA), RNA template and pyrogen-free water. Together with the investigated gene commercially available DNA standards (Applied Biosystems, CA, USA) of β-actin gene were amplified. The reverse transcription reaction was carried out at 50°C for 30 min. After initial activation of HotStar Taq DNA Polymerase was at 95°C for 15 min. Next, a two-stage reaction was carried out: 94°C for 15 s (denaturation); 60°C for 60 s (starter annealing). Final elongation of amplification products was carried out at 72°C for 10 min. Statistical analysis The number of mRNA copies determined in QRT-PCR analysis was the measure of mRNA concentration of the investigated genes (MMP-2, MMP-9, and TIMP-2) as well as constitutive genes (β-actin and GAPDH). Expression extent was judged based on mRNA copy numbers per 1 μg total RNA. To compare the investigated parameters in experimental and control groups Mann-Whitney U test was used. P>0.05 was considered as statistically significant.
The patients group was characterized by the presence of diagnosis, cholesterol, triglycerides, troponin I, creatinine, kinase activity, and by leukocytosis [Table 1] and [Table 2].
Reference and Affymetrix database search revealed presence of 204 metalloproteinase-related transcripts on their HG-U133A microarrays. In order to eliminate the unwanted variability between microarrays the results were normalized. Homogeneity of the investigated group was assessed by hierarchical clusterization [Figure 1]. Euclidean distance taken as a measure of similarity, witch determines expression differences using analyzed parameters. Cluster analysis was performed using Cluster version 3.0, and the results were visualized by Java Treeview software.
Cluster analysis of 204 transcripts of metalloproteinases-linked genes has shown a uniform division of the whole experimental group into ACS patients and healthy individuals. Using criteria described in the Materials and Methods Section, genes differentiating between ACS patients and healthy persons were selected using Bland-Altman method. From among 204 metalloproteinase-related transcripts picked out from reference search and Affymetrix database, 9 genes that differentiate ACS patients from healthy individuals were selected by using Bland-Altmanm approach [Figure 2]. Three showed decreased expression: (1) Platelet derived growth factor D (PDGF-D), which affects MMP-2 and MMP-9 activities and monocyte migration and plays an important role in atherosclerosis; (2) NUAK family sucrose non-fermenting 1 (SNF1)-like kinase 1 (NUAK1) member of the AMP-activated protein kinase-related kinase family responsible for ATP production in the ischemic myocardium; (3) peroxisomal biogenesis factor 1 linked to metalloproteinase activation. The remaining six differentiating genes showed elevated expression. They were: (1) MMP-2 and (2) MMP-9, taking part in plaque formation and destabilization and thus in the development of ACS and infarction; (3) CDK5RAP3 (CDK5 regulatory subunit associated protein 3) linked to regulation of vascular tension and blood pressure; (4) transmembrane BAX inhibitor motif containing 1 playing a role in apoptosis; (5) adenylate cyclase-associated protein 1 an MMP-9 substrate, and (6) TIMP-2 inhibiting expression of MMP.
As mentioned before the selected differentiating genes are mainly linked to atherosclerotic processes, including cell migration and apoptosis, and they participate in the regulation of vascular tension and blood pressure. Since the majority of the mentioned genes are linked to MMP-2 and MMP-9 activation we decided to assess their expression by quantitative RT-PCR (quantitative real time polymerase chain reaction). Transcriptional activity of the chosen metalloproteinase genes in the group of ACS patients and in the control group was assessed by QRT-PCR. The carried out analysis demonstrated lack of statistically significant differences in the expression of constitutive genes (β-actin and GAPDH). The reported results have been calculated in terms of GAPDH [Figure 3].
Analysis showed that elevated expression of MMP-2 and MMP-9, as well that of their tissue inhibitor TIMP-2 was statistically significant in the group of ACS patients as compared to control.
Metalloproteinases, which contribute to extracellular matrix scaffold, play a significant role in the destabilization of atherosclerotic plaque, leading to blood clot formation and cardiac arrest. We attempted to investigate, using oligonucleotide microarrays the expression of genes that seemed helpful in differentiating between patients with acute coronary syndrome (ACS) and healthy subjects, as well as to select among such genes those that seem crucial for manifestation of cardiovascular diseases. Gene expression is obviously only a starting point for analysis of protein product activity. Multi-stage processes following transcription might modify that activity, even despite high gene expression. Having that in mind, we focused on gene expression of the chosen metalloproteinases and their tissue inhibitor, and not on the analysis of protein level in patients' blood serum, as this would undoubtedly require a separate study. We investigated metalloproteinases occurring in the vascular wall, notably MMP-2 and MMP-9 which contributes significantly to destabilization of atherosclerotic plaque. [4] Our oligonucleotide microarray analysis of 204 transcripts linked to metalloproteinases and QRT-PCR analysis of transcriptional activity of MMP-2 and MMP-9, as well as their tissue inhibitor, demonstrated their significantly elevated expression in ACS patients. This correlates with Kułach report, which indicated a significantly higher overexpression of MMP-2 and MMP-9 in monocytes from ACS patients.[5] Our results confirm the conclusions of a 1998 study by Kai et al. [6] performed in patients with various forms of coronary disease. These authors also observed elevated concentration of MMP-2 and MMP-9 in the serum of ACS patients as well as unstable coronary disease patients, when compared to the control group. Similarly, elevated MMP-2 and MMP-9 activity in the serum of ACS patients was found by Gresele et al. [7] Although investigating MMP-2, MMP-3 and MMP-9 levels in ACS patients Dhillon et al. [8] noticed elevated concentrations of MMP-2 in the group of patients who died due to coronary disease. They concluded that the values of MMP-2 in the upper quartile correlate with elevated patient mortality. In turn Dahi et al. [9] investigating MMP-2 expression in a transgenic murine model, noticed that its higher expression is linked to lesions leading to coronary artery ectasia. Although, observed that myocardial infarction patients with elevated and non-elevated ST- segment Brunner et al. [10] shown increased expression of MMP-9. Correlations between biomarkers of chronic ischemic heart disease and myocardial muscle damage were studied by Beygui et al. [11] after 2 months from infarction revealed increased expression of MMP-9, correlating independently with interleukin-6, B-type natriuretic peptide and aldosterone. The importance of metalloproteinase-9 as a biomarker of atherosclerotic plaque destabilization was highlighted by Nurkic et al., [12] who investigated 150 ACS patients including those with unstable angina and acute myocardial infarction. They showed statistically significant differences in MMP-9 expression in the examined groups. They also noticed that higher MMP-9 concentration in patients' serum occurs among patients with acute myocardial infarction as compared to patients with unstable angina. Chen et al's [13] opinion elevated expression of MMP-9 is responsible for pathological lesions of coronary arteries associated with this disease. Elevated concentrations of MMP-9 were also found in the serum of patients suffering from both ACS and type 2 diabetes. When comparing total and active MMP-9 in ACS patients with type 2 diabetes and controls, significant decrease in the levels of the investigated metalloproteinase was observed in the group of ACS patients with diabetes. [14] A study conducted by Huang et al.[15] has shown the elevated expression of metalloproteinases to be responsible for macrophage aggregation leading to atherosclerotic plaque rupture. Fan et al. [16] observed that increased enzymatic activity of MMP-9 leads consequently to the development of ACS and increased mortality. Besides high serum concentration of MMPs, a substantial risk factor in ACS is the temporary imbalance in the system involving metalloproteinases/TIMP. It has been stressed by several authors that although TIMPs concentration in the examined tissues are elevated, they do not compensate for elevated activity of metalloproteinases. [17],[18] Shah et al.[19] compared concentrations of MMP-7 and MMP-8 as well as their tissue inhibitors (TIMP-1 and TIMP-2) from peripheral blood of ACS patients, including acute myocardial infarction and stable angina (SA) cases. They have shown significant decrease of TIMP-2 in acute myocardial infarction patients. Kelly et al.[20] who investigated association between TIMP levels and occurrence of major adverse cardiac events have concluded higher TIMP-1, TIMP-2 and TIMP-4 levels in patients with history of diabetes and hypertension. In addition, all TIMP levels were higher in women than in men. This analysis suggested that TIMPs levels may be useful as a treatment response marker. Although investigating hospital-admitted patients treated for acute heart failure syndrome (AHFS), patients with chronic stable HF, and control subjects without (heart failure) HF, Biolo et al.[21] observed that TIMP-1 levels were elevated in patients with AHFS, compared to those with stable HF or non-HF controls. In contrast, there was no difference in TIPM-2 levels in patients with AHFS compared with stable HF. However, these authors have shown differences in biomarker levels, depending on etiology. Tayebjee et al.[22] demonstrated higher concentrations of MMP-9 and TIMP-2 also in the serum of patients with SA. It was also shown that MMP-9 concentration among patients with coronary syndrome was higher in women. Higher elevation of MMP-9 was also demonstrated in ACS patients as compared to patients with SA. Other reports, together with ours, indicate that MMP-9 plays an important role in destabilization of atherosclerotic plaque. Some researchers have suggested that MMP-9 expression could be a prognostic marker both acute coronary syndromes and coronary diseases. Inhibiting expression of this endopeptidase may lead to plaque stabilization and decreased frequency of cardiovascular episodes. [23] The results of a study involving ACS patients treated by placement in hyperbaric chamber raise a prospect of successful treatment since in patients undergoing such treatment expression of MMP-9 had been significantly decreased. [24]
The results obtained in this study permit to conclude that increased gene expression of the investigated metalloproteinases (MMP-2 and MMP-9) and their TIMP-2 is the main cause underlying disturbances of the metalloproteinases/tissue inhibitors system which are responsible for destabilization of atherosclerotic plaque and occurrence of ACS in the investigated group of patients.
The research project entitled "Oligonucleotide microarray study of proinflammatory genes expression profile in mononuclear peripheral blood cells and right atrium cells obtained from atherosclerotic and ACS (unstable coronary disease, myocardial infarction) patients" and which was designed according to Declaration of Helsinki-based GCP guidelines was positively endorsed by the Bioethics Commission of the Medical University of Silesia in Katowice on December 21, 2004 (resolution NN-6501-223/I/04). The experimental part of this study was performed at the laboratories of the Department of Molecular Biology, the Silesian Medical University in Katowice.
[Figure 1], [Figure 2], [Figure 3]
[Table 1], [Table 2]
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||
